|
Left Crispr |
Right Crispr |
Crispr ID |
1116925825 |
1116925828 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:50635868-50635890
|
14:50635898-50635920
|
Sequence |
CCCAGCTACTTCTGTATTTTTAG |
AGAGTTTCACCATGTTGGCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 211, 2: 8927, 3: 22915, 4: 15202} |
{0: 2254, 1: 39161, 2: 131464, 3: 186810, 4: 200210} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|