ID: 1116940798_1116940802

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1116940798 1116940802
Species Human (GRCh38) Human (GRCh38)
Location 14:50789024-50789046 14:50789059-50789081
Sequence CCCTAAGCTGGGATCCAGAAGTC CAATCAAAACAAAGAAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135} {0: 1, 1: 1, 2: 3, 3: 35, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!