ID: 1117024709_1117024721

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1117024709 1117024721
Species Human (GRCh38) Human (GRCh38)
Location 14:51607789-51607811 14:51607838-51607860
Sequence CCTTCCGGGTGGGGCCCCTTTCC CTTGCGGTTGCGGTTCCGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154} {0: 1, 1: 0, 2: 0, 3: 2, 4: 12}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!