ID: 1117025567_1117025574

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1117025567 1117025574
Species Human (GRCh38) Human (GRCh38)
Location 14:51616547-51616569 14:51616578-51616600
Sequence CCTTTTTTCCTCCTCAGCAGCAG TGGTGAAGGAAGCTGGTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 81, 4: 693} {0: 1, 1: 0, 2: 1, 3: 22, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!