ID: 1117038277_1117038287

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1117038277 1117038287
Species Human (GRCh38) Human (GRCh38)
Location 14:51748584-51748606 14:51748602-51748624
Sequence CCCACCCCTCCCCCGGCAGCTCA GCTCATTGACGACCCAAAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 572} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!