|
Left Crispr |
Right Crispr |
Crispr ID |
1117058061 |
1117058066 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:51933074-51933096
|
14:51933100-51933122
|
Sequence |
CCCTAGAGCCTCTGGCAGGAGCA |
CTCTGCTGGCACCTTGATTTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 27, 3: 177, 4: 621} |
{0: 2, 1: 82, 2: 594, 3: 1800, 4: 3788} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|