ID: 1117071693_1117071707

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1117071693 1117071707
Species Human (GRCh38) Human (GRCh38)
Location 14:52063293-52063315 14:52063330-52063352
Sequence CCCCCAGGATCCCAGAGAGGAGA GGGAGAGGAGCAGCACAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 334} {0: 1, 1: 0, 2: 7, 3: 105, 4: 1365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!