ID: 1117120295_1117120303

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1117120295 1117120303
Species Human (GRCh38) Human (GRCh38)
Location 14:52560589-52560611 14:52560636-52560658
Sequence CCAGAATTAGACCCACATATATA AAGTGCCAAGGTAATTTAGTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 176, 3: 615, 4: 1806} {0: 1, 1: 0, 2: 16, 3: 70, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!