ID: 1117122577_1117122581

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1117122577 1117122581
Species Human (GRCh38) Human (GRCh38)
Location 14:52584228-52584250 14:52584270-52584292
Sequence CCAAAGACAATAAGTTTATTCAG CCAGGTTATATGTGCTAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 212} {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!