|
Left Crispr |
Right Crispr |
| Crispr ID |
1117151165 |
1117151166 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:52889851-52889873
|
14:52889866-52889888
|
| Sequence |
CCAGGTGTTGGCTCATGCTTGTA |
TGCTTGTAATCGCAACACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 47, 3: 204, 4: 625} |
{0: 3, 1: 414, 2: 13649, 3: 130012, 4: 259837} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|