|
Left Crispr |
Right Crispr |
| Crispr ID |
1117151165 |
1117151168 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:52889851-52889873
|
14:52889870-52889892
|
| Sequence |
CCAGGTGTTGGCTCATGCTTGTA |
TGTAATCGCAACACTTTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 47, 3: 204, 4: 625} |
{0: 106, 1: 24211, 2: 336685, 3: 258343, 4: 132559} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|