ID: 1117156829_1117156847

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1117156829 1117156847
Species Human (GRCh38) Human (GRCh38)
Location 14:52950653-52950675 14:52950703-52950725
Sequence CCGGCCACGGGCTGGGAGGTGGT TCGGGAGGGCGGCGGCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 243} {0: 1, 1: 0, 2: 6, 3: 52, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!