ID: 1117156831_1117156844

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1117156831 1117156844
Species Human (GRCh38) Human (GRCh38)
Location 14:52950657-52950679 14:52950695-52950717
Sequence CCACGGGCTGGGAGGTGGTGGAG GCAGAAACTCGGGAGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 552} {0: 1, 1: 0, 2: 2, 3: 20, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!