ID: 1117172306_1117172312

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1117172306 1117172312
Species Human (GRCh38) Human (GRCh38)
Location 14:53113549-53113571 14:53113581-53113603
Sequence CCCGTTCATTTCATTGGAAAAAT GAGAGTGAGCAGAAGCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 410} {0: 1, 1: 21, 2: 191, 3: 590, 4: 1266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!