ID: 1117187687_1117187688

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1117187687 1117187688
Species Human (GRCh38) Human (GRCh38)
Location 14:53258009-53258031 14:53258039-53258061
Sequence CCTTTAAATAAGCTTTGAACTAG TTGTCCACCTTTTTTTTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 64, 2: 65, 3: 64, 4: 233} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!