ID: 1117216840_1117216844

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1117216840 1117216844
Species Human (GRCh38) Human (GRCh38)
Location 14:53560148-53560170 14:53560186-53560208
Sequence CCTGCCATCTTCTGCAGATAACT GACACCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!