ID: 1117216841_1117216844

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1117216841 1117216844
Species Human (GRCh38) Human (GRCh38)
Location 14:53560152-53560174 14:53560186-53560208
Sequence CCATCTTCTGCAGATAACTACTC GACACCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 178, 1: 192, 2: 102, 3: 110, 4: 247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!