ID: 1117252161_1117252174

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1117252161 1117252174
Species Human (GRCh38) Human (GRCh38)
Location 14:53948855-53948877 14:53948888-53948910
Sequence CCCCATTGTCAACCCCCACCCAG TGGGATCCTAAACTTGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 225} {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
10 14:53948855-53948877 CCCCATTGTCAACCCCCACCCAG - 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG +