ID: 1117252162_1117252174

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1117252162 1117252174
Species Human (GRCh38) Human (GRCh38)
Location 14:53948856-53948878 14:53948888-53948910
Sequence CCCATTGTCAACCCCCACCCAGC TGGGATCCTAAACTTGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 186} {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
9 14:53948856-53948878 CCCATTGTCAACCCCCACCCAGC - 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG +