ID: 1117252169_1117252174

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1117252169 1117252174
Species Human (GRCh38) Human (GRCh38)
Location 14:53948870-53948892 14:53948888-53948910
Sequence CCACCCAGCCCAATCTGTTGGGA TGGGATCCTAAACTTGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 156} {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-5 14:53948870-53948892 CCACCCAGCCCAATCTGTTGGGA - 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG +