ID: 1117277735_1117277744 |
View in Genome Browser |
Spacer: 17 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1117277735 | 1117277744 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 14:54206652-54206674 | 14:54206692-54206714 |
Sequence | CCACATTCAAGAGAGCATGTGGG | CAGTCCAACCCAAGATCAAGGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 12, 4: 119} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |