|
Left Crispr |
Right Crispr |
| Crispr ID |
1117299162 |
1117299168 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:54407198-54407220
|
14:54407221-54407243
|
| Sequence |
CCTGCTCCTTCCTCTGGAAGTTT |
CGTCCCAGAGGGGCACCTGCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20, 1: 366, 2: 2766, 3: 2310, 4: 1421} |
{0: 3, 1: 4, 2: 7, 3: 20, 4: 172} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|