ID: 1117301006_1117301010

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1117301006 1117301010
Species Human (GRCh38) Human (GRCh38)
Location 14:54428051-54428073 14:54428077-54428099
Sequence CCTTCCAATTTTAGCAAGTAGAA CACAGCTGAAAGCTTAATGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 234} {0: 1, 1: 0, 2: 1, 3: 15, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!