ID: 1117305323_1117305333

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1117305323 1117305333
Species Human (GRCh38) Human (GRCh38)
Location 14:54468365-54468387 14:54468404-54468426
Sequence CCACCTAGACTTCAAAGGATCCC CAGAAAGATAATTGCCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 62, 4: 298} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!