ID: 1117327809_1117327816

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1117327809 1117327816
Species Human (GRCh38) Human (GRCh38)
Location 14:54684925-54684947 14:54684960-54684982
Sequence CCAGGTTTTCAAAGAGGCATTAA GAGGGTGGCCAGGAAGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 193} {0: 1, 1: 1, 2: 5, 3: 77, 4: 661}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!