ID: 1117331846_1117331848

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1117331846 1117331848
Species Human (GRCh38) Human (GRCh38)
Location 14:54720472-54720494 14:54720505-54720527
Sequence CCTGGCTGTTTTTGTGGGACTCA CATCTGCAATTCTTTTCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 201} {0: 1, 1: 0, 2: 3, 3: 24, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!