ID: 1117336766_1117336773

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1117336766 1117336773
Species Human (GRCh38) Human (GRCh38)
Location 14:54762613-54762635 14:54762654-54762676
Sequence CCTACTTCCTGAGAGACCCACAG TTACATTTTACCTACGTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 220} {0: 1, 1: 1, 2: 1, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!