ID: 1117343126_1117343134

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1117343126 1117343134
Species Human (GRCh38) Human (GRCh38)
Location 14:54808369-54808391 14:54808417-54808439
Sequence CCTGTTTGGCACCTGCAAAAAAC GTAGGGCCTGAAAAACCATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!