ID: 1117343131_1117343135

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1117343131 1117343135
Species Human (GRCh38) Human (GRCh38)
Location 14:54808399-54808421 14:54808421-54808443
Sequence CCAGCTCTTGGGATGAAAGTAGG GGCCTGAAAAACCATCTGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!