|
Left Crispr |
Right Crispr |
| Crispr ID |
1117348731 |
1117348738 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:54860020-54860042
|
14:54860048-54860070
|
| Sequence |
CCAGGACCCCTGTGTATACCCAA |
GCATACTCAAGTCCCGCAGTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 35, 3: 122, 4: 359} |
{0: 2, 1: 28, 2: 56, 3: 114, 4: 162} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|