|
Left Crispr |
Right Crispr |
| Crispr ID |
1117360796 |
1117360798 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:54971743-54971765
|
14:54971789-54971811
|
| Sequence |
CCACAGAATGCAAGAAAATGTTC |
TCTGATATCCAGAGTCTATAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 44, 3: 626, 4: 3890} |
{0: 1, 1: 77, 2: 1017, 3: 3349, 4: 5338} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|