ID: 1117361278_1117361280

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1117361278 1117361280
Species Human (GRCh38) Human (GRCh38)
Location 14:54976680-54976702 14:54976702-54976724
Sequence CCATACTGAGAAGTGTTGCTTCC CAATCTTTGAAAAATATTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136} {0: 1, 1: 0, 2: 11, 3: 102, 4: 894}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!