ID: 1117375347_1117375357

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1117375347 1117375357
Species Human (GRCh38) Human (GRCh38)
Location 14:55113904-55113926 14:55113936-55113958
Sequence CCCACCTTGGCCTCCCAAAGTGC TAGGCATGGACCACCATGCCTGG
Strand - +
Off-target summary {0: 28733, 1: 128252, 2: 230554, 3: 215949, 4: 130370} {0: 11, 1: 683, 2: 9325, 3: 39090, 4: 92033}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!