ID: 1117378466_1117378473

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1117378466 1117378473
Species Human (GRCh38) Human (GRCh38)
Location 14:55137082-55137104 14:55137105-55137127
Sequence CCCAGAGTAGGGGATGGGGCAGT TAGTGGGGACAGAGGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 269} {0: 1, 1: 0, 2: 1, 3: 75, 4: 593}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!