ID: 1117384370_1117384378

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1117384370 1117384378
Species Human (GRCh38) Human (GRCh38)
Location 14:55195828-55195850 14:55195856-55195878
Sequence CCCTCCCCAAAGTGCACAGATTC CCATACCACATGGCCACTGGTGG
Strand - +
Off-target summary {0: 11, 1: 39, 2: 121, 3: 185, 4: 491} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!