ID: 1117400794_1117400796

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1117400794 1117400796
Species Human (GRCh38) Human (GRCh38)
Location 14:55356984-55357006 14:55357006-55357028
Sequence CCGTTTTTCCTCAAAAAAGCTAG GTGTTGCAATCTTTGTGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 337} {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!