ID: 1117424506_1117424522

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1117424506 1117424522
Species Human (GRCh38) Human (GRCh38)
Location 14:55580489-55580511 14:55580527-55580549
Sequence CCGCCCGCTGGGTAGGCCTCGGG GCGGGGCTCTTGTTGGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105} {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!