ID: 1117431134_1117431136

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1117431134 1117431136
Species Human (GRCh38) Human (GRCh38)
Location 14:55662828-55662850 14:55662868-55662890
Sequence CCACAAAACTTGAGGTGAACTTG TCTTAACTGTGTTTTATTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 132} {0: 1, 1: 0, 2: 5, 3: 36, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!