ID: 1117481375_1117481380

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1117481375 1117481380
Species Human (GRCh38) Human (GRCh38)
Location 14:56148666-56148688 14:56148707-56148729
Sequence CCTCCTTTCTTCTGTGTTCTCTG CCTATTGTCCTTTGTCCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 791} {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!