|
Left Crispr |
Right Crispr |
| Crispr ID |
1117489408 |
1117489413 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:56231120-56231142
|
14:56231138-56231160
|
| Sequence |
CCTACAAAGAGACTTAGACTTCC |
CTTCCACACAGTAAAGTGGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 109, 1: 6809, 2: 3381, 3: 1541, 4: 942} |
{0: 1, 1: 0, 2: 1, 3: 18, 4: 166} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|