ID: 1117491148_1117491153

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1117491148 1117491153
Species Human (GRCh38) Human (GRCh38)
Location 14:56249298-56249320 14:56249342-56249364
Sequence CCCTCTTTCATTTAACATCCTTT ATCCACCCTCATCACATTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 642} {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!