ID: 1117507214_1117507218

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1117507214 1117507218
Species Human (GRCh38) Human (GRCh38)
Location 14:56415734-56415756 14:56415764-56415786
Sequence CCAGAAACATCCTTACAAGCATA ATAATGCTTTACCAGCTATCTGG
Strand - +
Off-target summary No data {0: 28, 1: 196, 2: 380, 3: 580, 4: 932}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!