ID: 1117532869_1117532872

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1117532869 1117532872
Species Human (GRCh38) Human (GRCh38)
Location 14:56676227-56676249 14:56676243-56676265
Sequence CCTTGAGATGACTGAGTGTTTCC TGTTTCCCTGGTTATTAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 292} {0: 1, 1: 0, 2: 4, 3: 19, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!