ID: 1117546593_1117546611

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1117546593 1117546611
Species Human (GRCh38) Human (GRCh38)
Location 14:56798405-56798427 14:56798451-56798473
Sequence CCTCGGCCTTGCCGCGGCCCACA AGGCCTGAGAACTACGCCCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!