ID: 1117573619_1117573628

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1117573619 1117573628
Species Human (GRCh38) Human (GRCh38)
Location 14:57074694-57074716 14:57074724-57074746
Sequence CCCATTCATTCTGCTTTGCAAAT CTTAAAGGGCCTGGGGAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 30, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!