ID: 1117589879_1117589885

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1117589879 1117589885
Species Human (GRCh38) Human (GRCh38)
Location 14:57256283-57256305 14:57256317-57256339
Sequence CCCTCAACCAATTCTGAAAATGT TTACAACCCTGGCCTAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 262} {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!