ID: 1117590761_1117590764

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1117590761 1117590764
Species Human (GRCh38) Human (GRCh38)
Location 14:57265804-57265826 14:57265830-57265852
Sequence CCTTACTCAGAATGTCTATCCTG AGATTTTAAAACACTGTACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 153} {0: 1, 1: 1, 2: 2, 3: 26, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!