ID: 1117595316_1117595325

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1117595316 1117595325
Species Human (GRCh38) Human (GRCh38)
Location 14:57321174-57321196 14:57321221-57321243
Sequence CCACCTGCCTTGGCCTCTCAAAG CCACCAAGTATGTTTTAAAGTGG
Strand - +
Off-target summary {0: 1185, 1: 28746, 2: 78716, 3: 152720, 4: 158266} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!