|
Left Crispr |
Right Crispr |
| Crispr ID |
1117624122 |
1117624134 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:57618335-57618357
|
14:57618382-57618404
|
| Sequence |
CCTGGTTCATCTCCCTGGGACTG |
GAGGGTAAGCAGAAGCAGGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 328, 2: 820, 3: 1295, 4: 1094} |
{0: 7, 1: 218, 2: 640, 3: 931, 4: 1220} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|