ID: 1117624126_1117624134

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1117624126 1117624134
Species Human (GRCh38) Human (GRCh38)
Location 14:57618348-57618370 14:57618382-57618404
Sequence CCTGGGACTGGTTAGACAGTGGG GAGGGTAAGCAGAAGCAGGGTGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 5, 3: 12, 4: 196} {0: 7, 1: 218, 2: 640, 3: 931, 4: 1220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!